We routinely produce dsRNA by in vitro transcription of a PCR generated DNA template containing the T7 promoter sequence on both ends (I. primer Designed dsRNA). It is also possible to produce dsRNA using PCR generated DNA templates containing either the T7 & SP6 or the T7 & T3 promoters on either end (II. dsRNA Fom Clones). This method is less efficient, especially when working on a large scale.

**All work should be done in a sterile, RNase free environment, using only sterile, RNase free solutions and materials, and while wearing gloves do reduce contamination.

I. Primer Designed dsRNA

A. Template Selection

Templates can be generated by PCR on cDNA (including ESTs from BDGP), genomic DNA, or first strand RT-cDNA. Most of the dsRNA should correspond to exons but dsRNA with two or more exons interrupted by introns will also work well. We generally aim for ~500 bp products although RNAi with products ranging from 150-3000bp have been shown to work. The target sequence should not contain complete 21-mer homology to other genes or your dsRNA could be non-specific. One case has been seen where the template contained one mismatch in a 21-mer identical stretch to another gene, and still only the level of the intended target was reduced, while the close homologue was unaffected. Since the targeted region within a transcript may influence the success of RNAi , the safest approach is to use dsRNA corresponding to the 5" or 3" UTR. It is recommended to check the various sequence sources (Publications, NCBI and BDGP, genomic and ESTs) to confirm the primary sequence of a given gene.

We suggest using the Primer3 website (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) for designing primers. Complementary sequences should be 20-24 nt, the Tm range between 59?C - 61?C and optimize against self-annealing by setting the Max Complementarity to 5 and Max 3" Complementarity to 1. After choosing the primer sequence, add the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) to the 5" end.

B. PCR

Perform a standard 50 or 100µl PCR reaction using your selected primer sequences to amplify the region of interest. Use 1-2 µl of a 10µM primer stock, 100-200 ng DNA as template and DNA polymerase. We have successfully used GENEChoice Taq (PGC Scientifics #62-6086-01), TaqPlus (Stratagene #600210), and Herculase (Stratagene #NC9690330) in the following PCR reaction conditions:

94oC - 3 min. 94oC - 45 sec. 57oC - 30 sec. 72oC - 45 sec. steps 2-4, 30x 72oC - 10 min.li
Check the PCR results to ensure that you have a band of the expected size. I run 4ul in a 1% agarose gel and use the small combs. I also us a 250bp ladder.

C. In vitro RNA Transcription

We use the Ambion MEGAscript T7 kit (Cat.# : 1334) for the transcription reaction. Follow the Ambion MEGAscript kit protocol for Transcription Reaction Assembly and use 5 µl of PCR template per 20 µl reaction. It is not necessary to purify the PCR template before transcription. We incubate the reaction in a heat block or thermocycler for 4 hours. Following incubation, we remove the DNA template with the DNase. Transcription and annealing occur simultaneously and no additional step is required to anneal the two complementary. If you want more dsRNA, scale up the reaction.

Confirm that the dsRNA product is the correct size using a 1% agarose gel with TBE or TAE buffer and load only 0.5 µl.